Overview
In this project, we were planning to incorporate 4-azido-L-phenylalanine into A27L, a membrane protein of vaccinia virus. However, the structure of vaccinia virus A27L has not been fully solved, especially for the N-terminal region. Herein, we employed AlphaFold 3 to predict the structure of the N-terminal region of A27L. By structure modeling and analysis, we found three phenylalanine residues close to the N-terminus of A27L which were ideal for 4-azido-L-phenylalanine replacement.
Model
Original Gene Sequence
ATGGACGGAACTCTTTCCCGGAGATGACGATCTTGCAATTCCAGCAACTGAATTTTTTTCTACAAAGGCTGCTAAAAAGCCAGAGGCTAAACGCGAAGCAATTGTTAAAGCCGATGAAGACGACAATGAGGAAACTCTCAAACAACGGCTAACTAATTTGGAAAAAAAGATTACTAATGTAACAACAAAGTTTGAACAAATAGAAAAGTGTTGTAAACGCAACGATGAAGTTCTATTTAGGTTGGAAAATCACGCTGAAACTCTAAGAGCGGCTATGATATCTCTGGCTAAAAAGATTGATGTTCAGACTGGACGGCGCCCATATGAGTAA
Mutated Gene SequenceATGGACGGAACTCTTTAGCCCGGAGATGACGATCTTGCAATTCCAGCAACTGAATAGTAGTCTACAAAGGCTGCTAAAAAGCCAGAGGCTAAACGCGAAGCAATTGTTAAAGCCGATGAAGACGACAATGAGGAAACTCTCAAACAACGGCTAACTAATTTGGAAAAAAAGATTACTAATGTAACAACAAAGTTTGAACAAATAGAAAAGTGTTGTAAACGCAACGATGAAGTTCTATTTAGGTTGGAAAATCACGCTGAAACTCTAAGAGCGGCTATGATATCTCTGGCTAAAAAGATTGATGTTCAGACTGGACGGCGTCCATATGGGTAA
As illustrated in the following figure, mutations have occurred at three specific sites.
This gene sequence was used with AlphaFold 3 to predict the protein's spatial structure. The final determined JSON hyperparameters are as follows:
The results of the modeling process are illustrated in the following figure:
The red areas indicate the mutations in the gene sequence.
The image below shows other protein structures obtained after tuning the parameters.
